Details of Primer Pair 'ABC04580_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC04580_L01R01413Nils Rostoks2004-01-26 ABC04580_L01 GGAGGGTCGTCTTTGCAGGA 840 20 Nils Rostoks 2004-01-26 Illumina
ABC04580_R01 GCGACGGATTTGCAGATGG 1252 19 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC04580_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes