Details of Primer Pair 'ABC04622_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC04622_L01R01420Nils Rostoks2004-01-26 ABC04622_L01 TGGACGTGCTGAAGCTGGTG 299 20 Nils Rostoks 2004-01-26 Illumina
ABC04622_R01 CCGAAGTTAGCCAGCCATGC 718 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC04622_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes