Details of Primer Pair 'ABC04676_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC04676_L01R01408Nils Rostoks2004-01-26 ABC04676_L01 TACAAGGGCTTCCAGGTGGC 1160 20 Nils Rostoks 2004-01-26 Illumina
ABC04676_R01 CCTCCTCCGACCATTTCGTG 1567 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC04676_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes