Details of Primer Pair 'ABC04704_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC04704_L01R01414Nils Rostoks2004-01-26 ABC04704_L01 AGATGCAAGGCAACACGCAA 378 20 Nils Rostoks 2004-01-26 Illumina
ABC04704_R01 CAATCACTCGGCGACTCGAA 791 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC04704_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes