Details of Primer Pair 'ABC04725_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC04725_L01R01598Nils Rostoks2004-01-26 ABC04725_L01 GCTCCTCCACAAGAAGCCCA 1064 20 Nils Rostoks 2004-01-26 Illumina
ABC04725_R01 TTTCGGCCCATTGTTTGCTT 1661 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC04725_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes