Details of Primer Pair 'ABC04730_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC04730_L01R01478Nils Rostoks2004-01-26 ABC04730_L01 CCACCTGGTGAAGAAAGCGG 703 20 Nils Rostoks 2004-01-26 Illumina
ABC04730_R01 TACACAACGAAGTCCCCGCA 1180 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC04730_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes