Details of Primer Pair 'ABC04759_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC04759_L01R010Nils Rostoks2004-05-27 ABC04759_L01 CACACCCAACACCGTGATCC 0 20 Nils Rostoks 2004-05-27 Qiagen
ABC04759_R01 TTCCCGTCCGTCACAACTCA 41 20 Nils Rostoks 2004-05-27 Qiagen

Comment History of 'ABC04759_L01R01'

DateSubmitterComment
2004-05-27 Nils Rostoks Preliminary experiment, many primers were designed from Contest contigs and do not match HarvEST contigs, contig orientation was not checked, sometimes primer start and fragment size could not be determined