Details of Primer Pair 'ABC04803_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC04803_L01R01523Nils Rostoks2004-01-26 ABC04803_L01 AGTTGGGTTGAAGGGCCAGC 686 20 Nils Rostoks 2004-01-26 Illumina
ABC04803_R01 TCTGGGTGCTGCAATGGAAA 1208 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC04803_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes