Details of Primer Pair 'ABC04826_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC04826_L01R01405Nils Rostoks2004-01-26 ABC04826_L01 TGATTGGGACAACAAGGCCA 1900 20 Nils Rostoks 2004-01-26 Illumina
ABC04826_R01 ACAGGTCATCAAAGGGGCCA 2304 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC04826_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes