Details of Primer Pair 'ABC04853_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC04853_L01R01404Nils Rostoks2004-01-26 ABC04853_L01 CCCGTGGGTGTTGAAGGTCT 2126 20 Nils Rostoks 2004-01-26 Illumina
ABC04853_R01 GCAATTGCAGATGCTGCTGG 2529 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC04853_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes