Details of Primer Pair 'ABC04861_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC04861_L01R01524Nils Rostoks2004-01-26 ABC04861_L01 GCAAGGGTGGAAAGCGAGAA 525 20 Nils Rostoks 2004-01-26 Illumina
ABC04861_R01 CCGAACACCTGTCCTGGGAG 1048 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC04861_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes