Details of Primer Pair 'ABC04923_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC04923_L01R01517Nils Rostoks2004-01-26 ABC04923_L01 CGCAACGAAGACATGATCCG 142 20 Nils Rostoks 2004-01-26 Illumina
ABC04923_R01 CAAAACCGTGAATTTGGCCG 658 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC04923_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes