Details of Primer Pair 'ABC04992_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC04992_L01R01444Nils Rostoks2004-01-26 ABC04992_L01 TGTATGCATGGGCAACCTGG 1577 20 Nils Rostoks 2004-01-26 Illumina
ABC04992_R01 TCCAGGAACAACAGTCGCCA 2020 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC04992_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes