Details of Primer Pair 'ABC05005_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05005_L01R01469Nils Rostoks2004-01-26 ABC05005_L01 GCTGGTGCTGTTCCAGCAGA 447 20 Nils Rostoks 2004-01-26 Illumina
ABC05005_R01 TGCCAAAAGAAATGCAGCCA 915 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC05005_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes