Details of Primer Pair 'ABC05029_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05029_L01R01444Nils Rostoks2004-01-26 ABC05029_L01 AGGTTGAGGGTGATTCGGCA 276 20 Nils Rostoks 2004-01-26 Illumina
ABC05029_R01 GGGCTGAGACAGCAGGTGGT 719 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC05029_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes