Details of Primer Pair 'ABC05033_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05033_L01R01433Nils Rostoks2004-01-26 ABC05033_L01 TCGAGGGTCAGATGCTGTCG 1539 20 Nils Rostoks 2004-01-26 Illumina
ABC05033_R01 CAAGCGCCGTATGGTGTGTC 1971 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC05033_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes