Details of Primer Pair 'ABC05061_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05061_L01R01464Nils Rostoks2004-01-26 ABC05061_L01 GGGCAGACTGTGGCATACCC 955 20 Nils Rostoks 2004-01-26 Illumina
ABC05061_R01 GAGTGCGGCAGCAATTAGGG 1418 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC05061_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes