Details of Primer Pair 'ABC05096_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05096_L01R01470Nils Rostoks2004-01-26 ABC05096_L01 TCAGATGCCCCGGAAAAGAC 2022 20 Nils Rostoks 2004-01-26 Illumina
ABC05096_R01 CCTGAAGGCGGATGCACTCT 2491 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC05096_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes