Details of Primer Pair 'ABC05122_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05122_L01R01483Nils Rostoks2004-01-26 ABC05122_L01 TTTGGCCAACAAGCGAACAA 1234 20 Nils Rostoks 2004-01-26 Illumina
ABC05122_R01 TTCCAGCTTTGCATACGGCA 1716 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC05122_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes