Details of Primer Pair 'ABC05128_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05128_L01R01407Nils Rostoks2004-01-26 ABC05128_L01 TTGACGTTGTTGCTGCCAGG 610 20 Nils Rostoks 2004-01-26 Illumina
ABC05128_R01 CCCTCGCTTGACTCTGCGTT 1016 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC05128_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes