Details of Primer Pair 'ABC05189_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05189_L01R01488Nils Rostoks2004-01-26 ABC05189_L01 CAACGTGGGCACAAACCGTA 342 20 Nils Rostoks 2004-01-26 Illumina
ABC05189_R01 TGCCATTTATGGTCATGCCG 829 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC05189_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes