Details of Primer Pair 'ABC05236_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05236_L01R01430Nils Rostoks2004-01-26 ABC05236_L01 CAGTTCGCCGAGCGTAATCC 508 20 Nils Rostoks 2004-01-26 Illumina
ABC05236_R01 TTCCAGAGGGGATGAGCGAG 937 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC05236_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes