Details of Primer Pair 'ABC05241_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05241_L01R01526Nils Rostoks2004-01-26 ABC05241_L01 AGCTCGGCGACCACAGTTTC 1817 20 Nils Rostoks 2004-01-26 Illumina
ABC05241_R01 GCAGAGCAGCGACCAAATGA 2342 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC05241_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes