Details of Primer Pair 'ABC05281_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05281_L01R01205Nils Rostoks2005-03-17 ABC05281_L01 AACACACGCCTAATCCTTGG 1376 20 Nils Rostoks 2005-03-17 Invitrogen
ABC05281_R01 CCCGTCAAGACCTACAGCAT 1171 20 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC05281_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB