Details of Primer Pair 'ABC05345_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05345_L01R01511Nils Rostoks2004-01-26 ABC05345_L01 CTCAACCACTACCCGCCCTG 667 20 Nils Rostoks 2004-01-26 Illumina
ABC05345_R01 GGTGGCATGCTTGTAGCTCG 1177 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC05345_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes