Details of Primer Pair 'ABC05351_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05351_L01R01599Nils Rostoks2004-01-26 ABC05351_L01 CGGCCCTCAGACCAGACCTA 960 20 Nils Rostoks 2004-01-26 Illumina
ABC05351_R01 GCAACTAAACACCCCTGCCG 1558 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC05351_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes