Details of Primer Pair 'ABC05362_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05362_L01R01516Nils Rostoks2004-01-26 ABC05362_L01 TACACGCCGGCCTTCATCTT 1511 20 Nils Rostoks 2004-01-26 Illumina
ABC05362_R01 AAAAGGGGGCAAATCAAGCG 2026 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC05362_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes