Details of Primer Pair 'ABC05508_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05508_L01R01458Nils Rostoks2004-01-26 ABC05508_L01 GAGTTCAGCCGGACGCTGTT 807 20 Nils Rostoks 2004-01-26 Illumina
ABC05508_R01 TTCCCAGTCTTTTGAGGCCG 1264 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC05508_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes