Details of Primer Pair 'ABC05580_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05580_L01R01566Nils Rostoks2004-01-26 ABC05580_L01 GCCCCGGTGAAGGGAGTAAG 1335 20 Nils Rostoks 2004-01-26 Illumina
ABC05580_R01 CCGCGATTCTCGTCCCTCT 1900 19 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC05580_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes