Details of Primer Pair 'ABC05599_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05599_L01R01186Nils Rostoks2005-03-17 ABC05599_L01 TTCCATCATAACAGCAATGG 1165 20 Nils Rostoks 2005-03-17 Invitrogen
ABC05599_R01 TTCGTCGAAGGCTATGTAGG 979 20 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC05599_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB