Details of Primer Pair 'ABC05623_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05623_L01R01638Nils Rostoks2004-05-27 ABC05623_L01 GTCCCAGCCAGATTGTAGTCCA 963 22 Nils Rostoks 2004-05-27 Qiagen
ABC05623_R01 CCGGAGGGCACTGAAGTATG 325 20 Nils Rostoks 2004-05-27 Qiagen

Comment History of 'ABC05623_L01R01'

DateSubmitterComment
2004-05-27 Nils Rostoks Preliminary experiment, many primers were designed from Contest contigs and do not match HarvEST contigs, contig orientation was not checked, sometimes primer start and fragment size could not be determined