Details of Primer Pair 'ABC05640_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05640_L01R01468Nils Rostoks2004-01-26 ABC05640_L01 GTCAGCTTGCGGGGAACAAC 896 20 Nils Rostoks 2004-01-26 Illumina
ABC05640_R01 CGTGAACCGATGCCAAATCC 1363 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC05640_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes