Details of Primer Pair 'ABC05704_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05704_L01R01403Nils Rostoks2004-01-26 ABC05704_L01 ACACGAGTGCTCTGCCATGC 1122 20 Nils Rostoks 2004-01-26 Illumina
ABC05704_R01 CCACACCATTCCACACAGCC 1524 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC05704_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes