Details of Primer Pair 'ABC05737_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05737_L01R01400Nils Rostoks2004-01-26 ABC05737_L01 ACCAACGCCACCGTCAAGTT 730 20 Nils Rostoks 2004-01-26 Illumina
ABC05737_R01 CCTTCTCGAGTGAGACGGGC 1129 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC05737_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes