Details of Primer Pair 'ABC05754_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05754_L01R01410Nils Rostoks2004-01-26 ABC05754_L01 CGCATACCACACCCGGTACA 428 20 Nils Rostoks 2004-01-26 Illumina
ABC05754_R01 GGCCCAACCAGGAAATCTCA 837 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC05754_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes