Details of Primer Pair 'ABC05772_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05772_L01R01591Nils Rostoks2004-01-26 ABC05772_L01 AGCATTGCATGATTCCACGG 1136 20 Nils Rostoks 2004-01-26 Illumina
ABC05772_R01 CGCATTGAAGCTTTGGTTGC 1726 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC05772_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes