Details of Primer Pair 'ABC05789_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05789_L01R01561Nils Rostoks2004-01-26 ABC05789_L01 ATGCCGCATCGTTCTCATCA 973 20 Nils Rostoks 2004-01-26 Illumina
ABC05789_R01 AATGTGGCAGCATGGCAATC 1533 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC05789_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes