Details of Primer Pair 'ABC05800_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05800_L01R01494Nils Rostoks2004-01-26 ABC05800_L01 GCAGCATCAGGCCATTCTGA 1671 20 Nils Rostoks 2004-01-26 Illumina
ABC05800_R01 TGCACAAAACCGTCCAGGAG 2164 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC05800_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes