Details of Primer Pair 'ABC05809_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05809_L01R01428Nils Rostoks2004-01-26 ABC05809_L01 GCTGATGCTCCCCCTTCCTT 1291 20 Nils Rostoks 2004-01-26 Illumina
ABC05809_R01 CGCGCAGTAGACAAGGGACA 1718 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC05809_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes