Details of Primer Pair 'ABC05814_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05814_L01R01408Nils Rostoks2004-01-26 ABC05814_L01 AGGCACTGCTGTCATGCTGG 332 20 Nils Rostoks 2004-01-26 Illumina
ABC05814_R01 TTTTCAATCGGGCGTCTTCC 739 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC05814_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes