Details of Primer Pair 'ABC05818_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05818_L01R01503Nils Rostoks2004-01-26 ABC05818_L01 AGGCCACAAAACCTTTGGCA 1063 20 Nils Rostoks 2004-01-26 Illumina
ABC05818_R01 CCATGAACCCCTGCTTCACC 1565 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC05818_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes