Details of Primer Pair 'ABC05836_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05836_L01R01401Nils Rostoks2004-01-26 ABC05836_L01 TGCATGGCGGTGACATTCTT 1066 20 Nils Rostoks 2004-01-26 Illumina
ABC05836_R01 CAGGCAACTGTGTGCCAGCTA 1466 21 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC05836_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes