Details of Primer Pair 'ABC05852_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05852_L01R01496Nils Rostoks2004-01-26 ABC05852_L01 TCGAGGCTCCAGTTTCAGGC 589 20 Nils Rostoks 2004-01-26 Illumina
ABC05852_R01 ATGACCGCGGAGAAGTCCTG 1084 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC05852_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes