Details of Primer Pair 'ABC05866_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05866_L01R01412Nils Rostoks2004-01-26 ABC05866_L01 TCAAATGGGCATGCGAAGAA 1642 20 Nils Rostoks 2004-01-26 Illumina
ABC05866_R01 CGGAACACCCAAATTCGCTT 2053 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC05866_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes