Details of Primer Pair 'ABC05919_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05919_L01R01409Nils Rostoks2004-01-26 ABC05919_L01 TTCTGCCTGTGTCCATTGGG 1102 20 Nils Rostoks 2004-01-26 Illumina
ABC05919_R01 ACCAAGGCTTCAGGTCACCG 1510 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC05919_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes