Details of Primer Pair 'ABC05926_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05926_L01R01451Nils Rostoks2004-01-26 ABC05926_L01 CCAACACTTGGTGTGAGGCG 150 20 Nils Rostoks 2004-01-26 Illumina
ABC05926_R01 GCTAACCATCAGCCCCATGC 600 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC05926_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes