Details of Primer Pair 'ABC05939_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05939_L01R01158Nils Rostoks2005-03-17 ABC05939_L01 TCATTGGGCTCTTCTACGG 1146 19 Nils Rostoks 2005-03-17 Invitrogen
ABC05939_R01 GCAAACCGGACTAAGTATGC 1304 20 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC05939_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB