Details of Primer Pair 'ABC05953_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05953_L01R01548Nils Rostoks2004-01-26 ABC05953_L01 GATGCCTGGAGGAAGGAGCA 464 20 Nils Rostoks 2004-01-26 Illumina
ABC05953_R01 CCGAGCATGGTCGATTGGAT 1011 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC05953_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes