Details of Primer Pair 'ABC05977_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05977_L01R01533Nils Rostoks2004-01-26 ABC05977_L01 GCGTGAAGCACAAGCCTCAG 95 20 Nils Rostoks 2004-01-26 Illumina
ABC05977_R01 ATCGACAACCACCAGCGACA 627 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC05977_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes