Details of Primer Pair 'ABC05995_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC05995_L01R01515Nils Rostoks2004-01-26 ABC05995_L01 CACCAGCAAGGGCGTCTACC 442 20 Nils Rostoks 2004-01-26 Illumina
ABC05995_R01 TGACGATCTGAGCGACGGAG 956 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC05995_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes